View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8632_low_1 (Length: 245)
Name: NF8632_low_1
Description: NF8632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8632_low_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 49944437 - 49944212
Alignment:
| Q |
1 |
ttgatgagaggaaaagttgtggttgatgcagttttgtcacatccaagtgtattgattgtgcagaagaaggattatagttggttagggataccaaacaatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49944437 |
ttgatgagaggaaaagttgtggttgatgcagttttgtcacatccaagtgtattgattgtgcagaagaaggattatagttggttagggataccaaacaatg |
49944338 |
T |
|
| Q |
101 |
aaggtggtacaaagaggcacttgtctactgaagaagggattgaccatcgaactagaacaaggagacttgcacgagaggaagccgcggttcactcggcagc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
49944337 |
aaggtggtacaaagaggcacttgtctactgaagaagggattgaccatcgaactagaacaaggagacttgcacgagaggaagccgcggttcaatcggcagc |
49944238 |
T |
|
| Q |
201 |
agaacgagactatgcagccagggtag |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
49944237 |
agaacgagactatgcagccagggtag |
49944212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 22 - 92
Target Start/End: Original strand, 1903505 - 1903575
Alignment:
| Q |
22 |
gttgatgcagttttgtcacatccaagtgtattgattgtgcagaagaaggattatagttggttagggatacc |
92 |
Q |
| |
|
|||||||| |||||| | || || ||||| ||| |||||||||||||||||| || |||||| |||||||| |
|
|
| T |
1903505 |
gttgatgcggttttgacgcagccgagtgtgttggttgtgcagaagaaggattttacttggttggggatacc |
1903575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University