View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8633_high_3 (Length: 519)

Name: NF8633_high_3
Description: NF8633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8633_high_3
NF8633_high_3
[»] chr7 (3 HSPs)
chr7 (214-500)||(7969180-7969466)
chr7 (263-500)||(37577638-37577873)
chr7 (330-399)||(32895222-32895287)
[»] chr5 (9 HSPs)
chr5 (263-497)||(32768431-32768662)
chr5 (278-497)||(32651175-32651391)
chr5 (263-463)||(25469920-25470117)
chr5 (418-500)||(25477842-25477924)
chr5 (418-500)||(32710673-32710755)
chr5 (330-433)||(32740594-32740694)
chr5 (418-500)||(32557359-32557441)
chr5 (406-485)||(32763443-32763522)
chr5 (264-342)||(28475450-28475529)
[»] chr1 (1 HSPs)
chr1 (427-500)||(17583921-17583994)
[»] chr4 (1 HSPs)
chr4 (263-314)||(2166106-2166159)


Alignment Details
Target: chr7 (Bit Score: 267; Significance: 1e-149; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 214 - 500
Target Start/End: Original strand, 7969180 - 7969466
Alignment:
Q  214 tccttaatagaacataaatcttatacagctcaagacaaaacagaaaaaacaataatgtattatttctctacttatagggagattgtcttcatgacaaggg 313  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
T  7969180 tccttaatagaacataaatcttatacagctcaagacaaaacagaaaaaacagtaatgtattatttctctacttatagggagattgtcttcatgacaaggg 7969279  T
Q  314 ttgccgacagcggcagatgatgaggtggatgattgcctgctcttggatttagtaatcggtgatgatggtgcagtggtcatctagtctccgatgaggcggc 413  Q
    |||||||||| |||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||    
T  7969280 ttgccgacagtggcagatgatgaggtggatgattgcctgcttttggatttagtaattggtgatgatggcgcagtggtcatctagtctccgatgaggcggc 7969379  T
Q  414 tgacgaggtggagggttgacctctcttggatgttgcaattggcaatggtcaggctgtcatctaattgcttactggcaaagatcagac 500  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7969380 tgacgaggtggagggttgacctctcttggatgttgcaattggcaatggtcaggctgtcatctaattgcttactggcaaagatcagac 7969466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 263 - 500
Target Start/End: Complemental strand, 37577873 - 37577638
Alignment:
Q  263 caataatgtattatttctctacttatagggagattgtcttcatgacaagggttgccgacagcggcagatgatgaggtggatgattgcctgctcttggatt 362  Q
    ||||||||||| | ||||| ||||||| || |||||||||||||||||||||  || || ||||||||  |||||||||| | |||| |||||||||||     
T  37577873 caataatgtatgacttctcaacttatatggtgattgtcttcatgacaagggtcaccaacggcggcagacaatgaggtggacggttgcatgctcttggatg 37577774  T
Q  363 tagtaatcggtgatgatggtgcagtggtcatctagtctccgatgaggcggctgacgaggtggagggttgacctctcttggatgttgcaattggcaatggt 462  Q
    || ||||||| |  ||| |||| | ||||||||| || || |||| ||||  |||||  | |||||||||| |||||||||||| | ||||||||| |||    
T  37577773 tattaatcgggg--gattgtgcggaggtcatctaatcccccatgatgcggaggacgaatttgagggttgacttctcttggatgtggtaattggcaagggt 37577676  T
Q  463 caggctgtcatctaattgcttactggcaaagatcagac 500  Q
    |||||| | ||||| || ||||| ||||||||||||||    
T  37577675 caggctattatctagttccttaccggcaaagatcagac 37577638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 330 - 399
Target Start/End: Complemental strand, 32895287 - 32895222
Alignment:
Q  330 atgatgaggtggatgattgcctgctcttggatttagtaatcggtgatgatggtgcagtggtcatctagtc 399  Q
    ||||| ||||||||| |||||||||||||||| ||||||| ||||||||    |||||||||||||||||    
T  32895287 atgataaggtggatggttgcctgctcttggatgtagtaat-ggtgatga---cgcagtggtcatctagtc 32895222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 60; Significance: 2e-25; HSPs: 9)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 263 - 497
Target Start/End: Complemental strand, 32768662 - 32768431
Alignment:
Q  263 caataatgtattatttctctacttatagggagattgtcttcatgacaagggttgccgacagcggcagatgatgaggtggatgattgcctgctcttggatt 362  Q
    ||||||||||||| ||  |||||||||||| | |||||||||||| ||||||  ||||| |||||| | ||||||||||| |  |||||||||||| |      
T  32768662 caataatgtattactttactacttatagggtgtttgtcttcatgataagggtccccgacggcggcaaacgatgaggtggacggctgcctgctcttgaaaa 32768563  T
Q  363 tagtaatcggtgatgatggtgcagtggtcatctagtctccgatgaggcggctgacgaggtggagggttgacctctcttggatgttgcaattggcaatggt 462  Q
     ||||||| | |||||| |||  ||| |||||||||| ||  | |||||| |||||| ||| ||| ||||| |||||||||||||||||||||||| |||    
T  32768562 cagtaatcagcgatgat-gtg--gtgatcatctagtccccagtaaggcggatgacgacgtgcaggattgacttctcttggatgttgcaattggcaagggt 32768466  T
Q  463 caggctgtcatctaattgcttactggcaaagatca 497  Q
    |  | ||||||||  |||| ||| |||||| ||||    
T  32768465 ctcgttgtcatctcgttgcctaccggcaaatatca 32768431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 278 - 497
Target Start/End: Original strand, 32651175 - 32651391
Alignment:
Q  278 tctctacttatagggagattgtcttcatgacaagggttgccgacagcggcagatgatgaggtggatgattgcctgctcttggatttagtaatcggtgatg 377  Q
    ||||||||||||||| || ||||||| ||| || |||||||||  || ||||||||||||||||| | ||| || ||||||||| ||||||||||    |    
T  32651175 tctctacttatagggtgactgtcttcgtgataacggttgccgatggcagcagatgatgaggtggacggttgacttctcttggatatagtaatcgg---cg 32651271  T
Q  378 atggtgcagtggtcatctagtctccgatgaggcggctgacgaggtggagggttgacctctcttggatgttgcaattggcaatggtcaggctgtcatctaa 477  Q
    |||||||||||||||||||||| |||||||  |||   | |||||| | ||||||| | ||||||||| || ||| ||||| | || ||| ||| ||||     
T  32651272 atggtgcagtggtcatctagtccccgatgacacggagaatgaggtgaatggttgacttatcttggatgatgtaatcggcaaggatccggccgtcctctag 32651371  T
Q  478 ttgcttactggcaaagatca 497  Q
    ||| ||||  ||||||||||    
T  32651372 ttgtttaccagcaaagatca 32651391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 263 - 463
Target Start/End: Complemental strand, 25470117 - 25469920
Alignment:
Q  263 caataatgtattatttctctacttatagggagattgtcttcatgacaagggttgccgacagcggcagatgatgaggtggatgattgcctgctcttggatt 362  Q
    ||||||| ||||| || ||||||||||||| |||||||||||||| |  ||| |||||  || || ||||||||||| |||| ||||||||||||||||     
T  25470117 caataatatattaattttctacttatagggtgattgtcttcatgatacaggtcgccgatggcagcggatgatgaggttgatggttgcctgctcttggatg 25470018  T
Q  363 tagtaatcggtgatgatggtgcagtggtcatctagtctccgatgaggcggctgacgaggtggagggttgacctctcttggatgttgcaattggcaatggt 462  Q
    ||||||||      ||||||   || ||| ||||||| || ||||||||   |||||||  || || |||| |||||| |||||||||||||||||||||    
T  25470017 tagtaatc---accgatggtttggttgtcgtctagtcgcccatgaggcgaaagacgaggaagatggctgacttctcttcgatgttgcaattggcaatggt 25469921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 418 - 500
Target Start/End: Complemental strand, 25477924 - 25477842
Alignment:
Q  418 gaggtggagggttgacctctcttggatgttgcaattggcaatggtcaggctgtcatctaattgcttactggcaaagatcagac 500  Q
    |||||||| ||||||| |||||||||||||| |||||||||||||| ||| ||| |||| |||||||| || ||| |||||||    
T  25477924 gaggtggatggttgacttctcttggatgttgtaattggcaatggtctggcagtcgtctagttgcttaccggaaaatatcagac 25477842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 418 - 500
Target Start/End: Complemental strand, 32710755 - 32710673
Alignment:
Q  418 gaggtggagggttgacctctcttggatgttgcaattggcaatggtcaggctgtcatctaattgcttactggcaaagatcagac 500  Q
    ||||| |||||||||| |||||||||||||| ||||||||| |||| | | |||| ||| || ||||||||||||||||||||    
T  32710755 gaggttgagggttgacttctcttggatgttgtaattggcaagggtctgacagtcagctagttccttactggcaaagatcagac 32710673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 330 - 433
Target Start/End: Complemental strand, 32740694 - 32740594
Alignment:
Q  330 atgatgaggtggatgattgcctgctcttggatttagtaatcggtgatgatggtgcagtggtcatctagtctccgatgaggcggctgacgaggtggagggt 429  Q
    ||||| |||||||  ||||||  ||||||||| ||||||||||||||| || ||   |||||||||||||||| | |||||||  |||||||||||||||    
T  32740694 atgataaggtggacaattgccaactcttggatgtagtaatcggtgatggtgttg---tggtcatctagtctccaaggaggcggaggacgaggtggagggt 32740598  T
Q  430 tgac 433  Q
    ||||    
T  32740597 tgac 32740594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 418 - 500
Target Start/End: Original strand, 32557359 - 32557441
Alignment:
Q  418 gaggtggagggttgacctctcttggatgttgcaattggcaatggtcaggctgtcatctaattgcttactggcaaagatcagac 500  Q
    |||||||||||||| | |||||||||||||| ||| ||||| |||  |||||||||||| | ||||| ||||||| |||||||    
T  32557359 gaggtggagggttgccttctcttggatgttgtaataggcaagggtatggctgtcatctagtagcttattggcaaacatcagac 32557441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 406 - 485
Target Start/End: Complemental strand, 32763522 - 32763443
Alignment:
Q  406 gaggcggctgacgaggtggagggttgacctctcttggatgttgcaattggcaatggtcaggctgtcatctaattgcttac 485  Q
    ||||||| ||| |||||||| ||||||  |||||||||||||| ||||||||| ||| ||| |||| ||||| |||||||    
T  32763522 gaggcggatgaggaggtggatggttgaattctcttggatgttgtaattggcaagggtaaggttgtcctctaactgcttac 32763443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 264 - 342
Target Start/End: Complemental strand, 28475529 - 28475450
Alignment:
Q  264 aataatgtattatttctctacttatagggag-attgtcttcatgacaagggttgccgacagcggcagatgatgaggtgga 342  Q
    ||||||| || | |||||||| ||||||| | |||||||||| || ||||||||||||||||||  || |||||||||||    
T  28475529 aataatgcatgacttctctacatatagggtggattgtcttcacgataagggttgccgacagcggtggacgatgaggtgga 28475450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 34; Significance: 0.0000000008; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 427 - 500
Target Start/End: Complemental strand, 17583994 - 17583921
Alignment:
Q  427 ggttgacctctcttggatgttgcaattggcaatggtcaggctgtcatctaattgcttactggcaaagatcagac 500  Q
    ||||||| |||||||||||||| ||| ||||| |||| || |||| |||| |||||||| | ||||||||||||    
T  17583994 ggttgacttctcttggatgttgtaatcggcaagggtccggttgtcctctagttgcttaccgtcaaagatcagac 17583921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 263 - 314
Target Start/End: Original strand, 2166106 - 2166159
Alignment:
Q  263 caataatgtat--tatttctctacttatagggagattgtcttcatgacaagggt 314  Q
    |||||||||||  ||| |||||| ||||| ||||||||||||||||||||||||    
T  2166106 caataatgtatgatatctctctagttataaggagattgtcttcatgacaagggt 2166159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University