View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8633_low_11 (Length: 389)
Name: NF8633_low_11
Description: NF8633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8633_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 20 - 250
Target Start/End: Complemental strand, 32000725 - 32000495
Alignment:
| Q |
20 |
tggtggtctagatcgatgttgtggacnnnnnnncaatgttagtttgtttattagagaatatggttattgagaaagcatcgggggtgatgaaattgagggt |
119 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32000725 |
tggtggtctagatcgatgttgtggaccttttttcaatgttagtttgtttattagagaatatggttattgagaaagcatcgggggtgatgaaattgagggt |
32000626 |
T |
 |
| Q |
120 |
gatgcagttgatgaaattgaagattttcccatcacgctgtcagataatgacaccattttctagtaaaaggtcattctggattcacaccgattagatcaaa |
219 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32000625 |
gatgcagttgatgaaattgaagattttcctatcacgctgtcagataatgacaccattttctagtaaaaggtcattctggattcacaccgattagatcaaa |
32000526 |
T |
 |
| Q |
220 |
aacccaaaagtatcctttgagattaaataga |
250 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |
|
|
| T |
32000525 |
aacccaaaagtatcccttgagattaaataga |
32000495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 302 - 374
Target Start/End: Complemental strand, 32000385 - 32000313
Alignment:
| Q |
302 |
ttgtctttacttataatagttttgtttgatgcatgtataggaggtgcatgtggttatggaaatttgtacaatc |
374 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32000385 |
ttgtctttacttataatagttttgtttgatgcatgtataggaggtgcatgtggttatggaaatttgtacaatc |
32000313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 247 - 303
Target Start/End: Complemental strand, 32000483 - 32000427
Alignment:
| Q |
247 |
tagatgcgctgactttctactcggggtttggttcttgtcccc-cgtaattttattttt |
303 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
32000483 |
tagatgcgctgactttccactc-gggtttggttcttgtccccttgtaattttattttt |
32000427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University