View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8633_low_14 (Length: 362)
Name: NF8633_low_14
Description: NF8633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8633_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 102; Significance: 1e-50; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 19 - 120
Target Start/End: Original strand, 54471666 - 54471767
Alignment:
| Q |
19 |
atatttgagggagctgagtgtgacttcttcagatcattctttataacaatgtcttctatttcccaagaatcttctccaggaccagacgctcaaaattcgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54471666 |
atatttgagggagctgagtgtgacttcttcagatcattctttataacaatgtcttctatttcccaagaatcttctccaggaccagacgctcaaaattcgt |
54471765 |
T |
|
| Q |
119 |
ct |
120 |
Q |
| |
|
|| |
|
|
| T |
54471766 |
ct |
54471767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 280 - 331
Target Start/End: Original strand, 54471927 - 54471978
Alignment:
| Q |
280 |
tctccgtctccgactccaccttctaacacttccccatctcaaccatcacaat |
331 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54471927 |
tctccgtctccgactccaccttctaacacttccccatctcaaccatcacaat |
54471978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University