View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8633_low_23 (Length: 253)
Name: NF8633_low_23
Description: NF8633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8633_low_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 40 - 169
Target Start/End: Original strand, 36538386 - 36538515
Alignment:
| Q |
40 |
ttgcaacaatctctctcgtgattgacccctccattatttatcgcttttaagaaatgcagagaatctcaaagctcactagctcaaaagaatttataggaat |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
36538386 |
ttgcaacaatctctctcgtgattgacccctccattatttatcgcttttaagaaatgccgagaatttcaaagctcactagctcaaaagaatttataggaat |
36538485 |
T |
 |
| Q |
140 |
agaagcattgatcacggttaataagcatat |
169 |
Q |
| |
|
| |||||||||||||||||||||||||||| |
|
|
| T |
36538486 |
acaagcattgatcacggttaataagcatat |
36538515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 161 - 238
Target Start/End: Original strand, 36539021 - 36539098
Alignment:
| Q |
161 |
taagcatatttcaaacggtaatttaataataaaataattgaaccaataaaactcatggtcacttcttttaagagttca |
238 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36539021 |
taagcatatttcaaacagtaatttattaataaaataattgaaccaataaaactcatggtcacttcttttaagagttca |
36539098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University