View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8633_low_24 (Length: 238)
Name: NF8633_low_24
Description: NF8633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8633_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 96; Significance: 3e-47; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 129 - 224
Target Start/End: Complemental strand, 36537524 - 36537429
Alignment:
| Q |
129 |
atttcttagaaaccgttccacttccaccaatgagctcattccgttaactaaccgttccactctcacgttccaagactaccaaaactactcaaattc |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36537524 |
atttcttagaaaccgttccacttccaccaatgagctcattccgttaactaaccgttccactctcacgttccaagactaccaaaactactcaaattc |
36537429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 52 - 133
Target Start/End: Complemental strand, 36537636 - 36537555
Alignment:
| Q |
52 |
acacataatttttgtaatttcgattaacaatggtgaatgagaatcactccattcattgggacttgggagcacactaaatttc |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36537636 |
acacataatttttgtaatttcgattaacaatggtgaatgaaaatcactccattcattgggacttgggagcacactaaatttc |
36537555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 8 - 37
Target Start/End: Complemental strand, 36537744 - 36537715
Alignment:
| Q |
8 |
tattttagaatatgaaaaatcattattgaa |
37 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
36537744 |
tattttagaatatgaaaaatcattattgaa |
36537715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University