View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8633_low_27 (Length: 233)
Name: NF8633_low_27
Description: NF8633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8633_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 1237647 - 1237856
Alignment:
| Q |
1 |
agtttgaattgtctttactttttttggaaaaccnnnnnnnnn-ccaatagaattcaaagtgaagtgttggtaaaaaagagttaagggaaggaagattgac |
99 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1237647 |
agtttgaattgtgtttactttttttggaaaaccttttttttctccaatagaattcaaagtgaagtgttggtaaaaaagagttaagagaaggaagattgac |
1237746 |
T |
 |
| Q |
100 |
acaaatgtttatcctagttcacctcacaatacaagattacgtttagtcccctttcacttctaaataattttttcgttctaatcaaacttgattacaacaa |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1237747 |
acaaatgtttatcctagttcacctcacaatacaagattacgtttaatcccctttcccttctaaataattttttcgttagaatcaaacttgattacaacaa |
1237846 |
T |
 |
| Q |
200 |
caaaaacact |
209 |
Q |
| |
|
|||||||||| |
|
|
| T |
1237847 |
caaaaacact |
1237856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University