View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8635_low_6 (Length: 211)
Name: NF8635_low_6
Description: NF8635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8635_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 79; Significance: 4e-37; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 107 - 193
Target Start/End: Original strand, 29243634 - 29243720
Alignment:
| Q |
107 |
aaatcgtggatttgatattattgaaaactgggtttagagtttaggggtttattaacgagattttgcgtttaaggtttagggttttta |
193 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
29243634 |
aaatcgtagatttgatattattgaaaactgggtttagagtttaggggtttattaacgagattttgcgtttaaggtatagggttttta |
29243720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 14 - 92
Target Start/End: Original strand, 29243531 - 29243609
Alignment:
| Q |
14 |
aattctgtaaaatcacttttattttggcttttataattaaggttgttgttgctctcaaaccatctcaataataccaaat |
92 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29243531 |
aattctgtaaaatcacatttattttggcttttataattaaggttgttgttgctctcaaaccatctcaataataccaaat |
29243609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University