View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8636_low_6 (Length: 378)
Name: NF8636_low_6
Description: NF8636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8636_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 332; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 332; E-Value: 0
Query Start/End: Original strand, 7 - 366
Target Start/End: Complemental strand, 36423146 - 36422787
Alignment:
| Q |
7 |
aatggaacattgagtacagcaaccatttcctcaagtgtcattgtagggtatccagaagaacctggccttgtttcatggttggttatttcacttgtgctaa |
106 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36423146 |
aatggaacatcgagtacagcaaccatttcctcaagtgtcattgtagggtatccagaagaacctggccttgtttcatggttggttatttcacttgtgctaa |
36423047 |
T |
|
| Q |
107 |
gatcaacagtgagagtgtgagtgacacgtttatcaagtgcaaccacagaggctttcctaggaagtaatggttgaccatttttccatttgaggacaagttc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36423046 |
gatcaacagtgagagtgtgagtgacacgtttatcaagtgcaaccacagaggctttcctaggaagtaatggttgaccatttttccatttgaggacaagttc |
36422947 |
T |
|
| Q |
207 |
tttgtctggttcttctagaacaatggaattgagagtgtaactgtttgaggacttaaaaagagggtgtgtcgagaggatcgcacgaactttgtggaaggct |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| || |
|
|
| T |
36422946 |
tttgtctggttcttctagaacaatggaattgagagtgtaactgtttgaggacttaaaaagagggtgtgtcgagaggatcgcacgaactttgttgaattct |
36422847 |
T |
|
| Q |
307 |
ttgagggttagagggtctaaagggtggcgaggttcgtcggattcatggtttggttgttga |
366 |
Q |
| |
|
| || |||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36422846 |
tggatggttagagggtctaaagggtggcgaggttcatcggattcatggtttggttgttga |
36422787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University