View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8636_low_9 (Length: 329)
Name: NF8636_low_9
Description: NF8636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8636_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 100 - 317
Target Start/End: Complemental strand, 37167657 - 37167440
Alignment:
| Q |
100 |
ctcctcctcctctctacaacagtttctctcgttagttgttatctcttcgttagttgctcctcctcccctctgttagtgatgatattagttagaactctaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37167657 |
ctcctcctcctctctacaacagtttctctcgttagttgttatctcttcgttagttgcttctccttccctctgttagtgatgatattagttagaactctaa |
37167558 |
T |
|
| Q |
200 |
tcaactagtttatactgctctcattacttatgttcaaatcccactagaaaaactttaatatacatggatctcctctcctagagtagacataagaagaaga |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37167557 |
tcaactagtttatactgctctcattacttatgttcaaatcccactagaaaatctttaatatacatggatctcctctcatagagtagacataagaagaaga |
37167458 |
T |
|
| Q |
300 |
aaaatactcatttgatat |
317 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
37167457 |
aaaatactcatttgatat |
37167440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 37167756 - 37167719
Alignment:
| Q |
1 |
tgattctttggtcgtttctctctatattgattcttcga |
38 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37167756 |
tgattctttggtcgtttctctctatattgattcttcga |
37167719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University