View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8637_low_10 (Length: 221)
Name: NF8637_low_10
Description: NF8637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8637_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 3416097 - 3416304
Alignment:
| Q |
1 |
gtgcttttacatggttgt---agatgaacgattggtgatgaaattataataaaagtgatggctgatacatgggtgtaatctc---aaaaccaaagtgtat |
94 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3416097 |
gtgcttttacatggttgttgtagatgaacgattggtgatgaaattataataaaagtgatggctgatacatgggtgtaatctcctcaaaaccaaagtgtat |
3416196 |
T |
|
| Q |
95 |
atgatgttggatggagagagaatatgtgatactaataaaattcattatttgtttcttgatgagagattgtagaagtattctagatcgtgcctctttttga |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3416197 |
atgatgttggatggagagagaatatgtgatactaataaaattcattatttgtttcttgatgagagattgtagaagtattctagatcgtgcctctttttga |
3416296 |
T |
|
| Q |
195 |
gtcagaaa |
202 |
Q |
| |
|
|||||||| |
|
|
| T |
3416297 |
gtcagaaa |
3416304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University