View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8637_low_5 (Length: 273)
Name: NF8637_low_5
Description: NF8637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8637_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 168; Significance: 4e-90; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 8 - 224
Target Start/End: Complemental strand, 10383021 - 10382813
Alignment:
| Q |
8 |
gtgggtagattattctgtgtgtgctctattattgtggaaaaggaaaagctatatggaatgtgggaatggtataggatgtttgatttgagaattttgcata |
107 |
Q |
| |
|
||||||| |||||| ||||||||| ||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10383021 |
gtgggtatattattatgtgtgtgcgctattattgtggaaaaggaaaagatatatggaatg--------gtataggatgtttgatttgagaattttgcata |
10382930 |
T |
 |
| Q |
108 |
tgatggtgtctaaaaagaaaagaattttggatatgatagtgtacatggatggatggctattatatgttctaccaaaaaagaatatttgcttagctcaatt |
207 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10382929 |
tgatgttgtctaaaaagaaaagaattttggatatgatagtgtacatggatggatggctattatatgttctaccaaaaaagaatatttgcttagctcaatt |
10382830 |
T |
 |
| Q |
208 |
cacaattctcatgctag |
224 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
10382829 |
cacaattctcatgctag |
10382813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 226 - 270
Target Start/End: Complemental strand, 10382775 - 10382731
Alignment:
| Q |
226 |
tataaagcatttccactgtggaaaaatttaccttagccattagat |
270 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||| |||||||| |
|
|
| T |
10382775 |
tataaagcatttctactatggaaaaatttaccttagtcattagat |
10382731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University