View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8638_high_18 (Length: 298)
Name: NF8638_high_18
Description: NF8638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8638_high_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 1e-50; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 165 - 274
Target Start/End: Complemental strand, 2091935 - 2091826
Alignment:
| Q |
165 |
agactttgagacaactccaatgaaacccttattatgtggtgaatttcactaacaagtgttgcataaaatattcgtgtaaataaataataagaaacaaagt |
264 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2091935 |
agactttgagacaactccaatgaaactcttattatgtggtgaatttcactaacaagtgttgcataaaatattagtgtaaataaataataagaaacaaagt |
2091836 |
T |
 |
| Q |
265 |
caaacaatat |
274 |
Q |
| |
|
|||||||||| |
|
|
| T |
2091835 |
caaacaatat |
2091826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 13 - 137
Target Start/End: Complemental strand, 2092086 - 2091962
Alignment:
| Q |
13 |
agcagagaggagcacattagtacctcggttttaggtgctaccatagcatagacggagaaaggaaaattagaaaaggaaaataaactcaagacctaaaacg |
112 |
Q |
| |
|
|||||||||||||||||||||| ||||||| | ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2092086 |
agcagagaggagcacattagtatctcggttgtgggtactaccatagcatagacggagaaaggaaaattagaaaaggaaaataaactcaagacctaaaacg |
2091987 |
T |
 |
| Q |
113 |
agtattataatcatttatatccgtt |
137 |
Q |
| |
|
|| |||||||||||| || |||||| |
|
|
| T |
2091986 |
agcattataatcattcatgtccgtt |
2091962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University