View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8638_high_20 (Length: 260)
Name: NF8638_high_20
Description: NF8638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8638_high_20 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 22 - 260
Target Start/End: Complemental strand, 32030038 - 32029800
Alignment:
| Q |
22 |
atgaaaaggttcttaccaagtctgccagtggaatcacaactagattttcattgcgaaggcgagaaaatgcccttgatctgagaattccaaatgcccagaa |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32030038 |
atgaaaaggttcttaccaagtctgccagtggaatcacaactagattttcattgcgaaggcgagaaaatgcccttgatctgagaattccaaatgcccagaa |
32029939 |
T |
|
| Q |
122 |
gaagtcatccagcgtcacaggagaaggaaaaagcttcttattagggagaatgatttctttttccagtttcagacattcattcttcacatattctttcaca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32029938 |
gaagtcatccagcgtcacaggagaaggaaaaagcttcttattagggagaatgatttctttttccagtttcagacattcattcttcacatattctttcaca |
32029839 |
T |
|
| Q |
222 |
gacagtgttgtgttcagaagttgagtacctactcaattc |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32029838 |
gacagtgttgtgttcagaagttgagtacctactcaattc |
32029800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University