View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8638_high_23 (Length: 229)
Name: NF8638_high_23
Description: NF8638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8638_high_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 38186695 - 38186900
Alignment:
| Q |
1 |
ttggtctgcgactgttgttttgataacaaagggactgttttgcgctaccag-----gtttttggtgcattgnnnnnnnggttttgtttggcttcggcagc |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38186695 |
ttggtctgcgactgttgttttgataacaaatggattgttttgcgctaccagcacaggtttttggtgcattgtttttttggttttgtttggcttcggcagc |
38186794 |
T |
 |
| Q |
96 |
ttggaggtgcttggcaatttttagtgaggcagaggtgtgcttcaggagtcagtgctgattaggcctggctgtgtgtatatgccgatctcactaattttgg |
195 |
Q |
| |
|
||||||||||| | |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38186795 |
ttggaggtgctcgacaatttttagtgaggcaggggtgtgcttcaggagtcagtgctgattaggcctggctgtgtgtatatgccgacctcactaattttgg |
38186894 |
T |
 |
| Q |
196 |
ggatgg |
201 |
Q |
| |
|
|||||| |
|
|
| T |
38186895 |
ggatgg |
38186900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University