View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8638_high_23 (Length: 229)

Name: NF8638_high_23
Description: NF8638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8638_high_23
NF8638_high_23
[»] chr8 (1 HSPs)
chr8 (1-201)||(38186695-38186900)


Alignment Details
Target: chr8 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 38186695 - 38186900
Alignment:
1 ttggtctgcgactgttgttttgataacaaagggactgttttgcgctaccag-----gtttttggtgcattgnnnnnnnggttttgtttggcttcggcagc 95  Q
    |||||||||||||||||||||||||||||| ||| ||||||||||||||||     |||||||||||||||       ||||||||||||||||||||||    
38186695 ttggtctgcgactgttgttttgataacaaatggattgttttgcgctaccagcacaggtttttggtgcattgtttttttggttttgtttggcttcggcagc 38186794  T
96 ttggaggtgcttggcaatttttagtgaggcagaggtgtgcttcaggagtcagtgctgattaggcctggctgtgtgtatatgccgatctcactaattttgg 195  Q
    ||||||||||| | |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
38186795 ttggaggtgctcgacaatttttagtgaggcaggggtgtgcttcaggagtcagtgctgattaggcctggctgtgtgtatatgccgacctcactaattttgg 38186894  T
196 ggatgg 201  Q
    ||||||    
38186895 ggatgg 38186900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University