View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8638_low_13 (Length: 391)
Name: NF8638_low_13
Description: NF8638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8638_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 4e-60; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 223 - 375
Target Start/End: Complemental strand, 1951848 - 1951698
Alignment:
| Q |
223 |
ttgttggtgatccaagctgctcttgttaatattggcactctaggaacaaagcaagatttaataacaaagtaattccttggaagtctgcagcagcttacat |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
1951848 |
ttgttggtgatccaagctgctcttgttaatattggcactctaggaacaaagcaagatttaataacaaagtaattccttggaagtctgcagcagc-----t |
1951754 |
T |
 |
| Q |
323 |
tacattatttgaaatgtttctctttcaagt---gtagcatagaccctcccaaagat |
375 |
Q |
| |
|
||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1951753 |
tacgttatttgaaatgtttctctttcaagtgtagtagcatagaccctcccaaagat |
1951698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 1 - 93
Target Start/End: Complemental strand, 1951943 - 1951851
Alignment:
| Q |
1 |
cagagagagtcaaggccaagttatctgcttgaaaagcatctctactctctattgctgggagagtacaacttgtcaaagcatgctattatatat |
93 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1951943 |
cagacagagtcaaggccaagttatctgcttgaaaagcatctctactctctattgctgggagagtacaacttgtcaaagcatgctattatatat |
1951851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 18 - 61
Target Start/End: Complemental strand, 13320610 - 13320567
Alignment:
| Q |
18 |
aagttatctgcttgaaaagcatctctactctctattgctgggag |
61 |
Q |
| |
|
||||||||||| || ||||||||||| ||||||||||||||||| |
|
|
| T |
13320610 |
aagttatctgcctggaaagcatctctcctctctattgctgggag |
13320567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University