View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8638_low_21 (Length: 284)
Name: NF8638_low_21
Description: NF8638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8638_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 79; Significance: 6e-37; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 1 - 147
Target Start/End: Original strand, 27205167 - 27205310
Alignment:
| Q |
1 |
tgagcaacggtatattcttctctgttcttcaaagggtattatagtataaatttactatggttaattaaataaggtgaatgaaagggtgaagctaattaat |
100 |
Q |
| |
|
|||||||| |||||||||| |||||||||||| ||||||||| |||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
27205167 |
tgagcaaccatatattcttccatgttcttcaaagt-tattatagtgtaaatttactatggttgattaaataaggtgaatgaaagggtgaagccaattaat |
27205265 |
T |
|
| Q |
101 |
taaaagaactttttgtttggtataaggtaattaacaaatcttaatag |
147 |
Q |
| |
|
| |||||| ||||| ||||||||||| |||||||||||| ||||||| |
|
|
| T |
27205266 |
t-aaagaaattttt-tttggtataagttaattaacaaattttaatag |
27205310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 206 - 276
Target Start/End: Original strand, 25963428 - 25963498
Alignment:
| Q |
206 |
tggtgtcgccgccaccagaacctagagttgctgtagtcgtatttctcttgaaaggcagatcgtttcttctc |
276 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||||||||||||||| |||||||| |||||| |
|
|
| T |
25963428 |
tggtgtcgccgccaccggaacctagagttgctgttgtcgtatttctcttgaaaggtagatcgttccttctc |
25963498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University