View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8639_low_12 (Length: 240)
Name: NF8639_low_12
Description: NF8639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8639_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 29273214 - 29272991
Alignment:
| Q |
1 |
tttgtcgggtggatttggatttcgttgggttaaatgagcccaaccgaaaccaaccaccataaacccatgtctttcaaaccgctcaacccggttcatccgc |
100 |
Q |
| |
|
|||||||| ||||| ||| ||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29273214 |
tttgtcggacggattcggacttcgttgggttaaatgagcccaaccaaaaccgaccaccataaacccatgtctttcaaaccgctcaacccggttcatccgc |
29273115 |
T |
 |
| Q |
101 |
tcaacccgaacagacatgcttcgggccatgcggtttggacaatttgggttggttaatgnnnnnnngttcagccctaattgatgcattaacannnnnnnga |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||||| ||||||| |||||||| |||||||||||||||||||||||||| || |
|
|
| T |
29273114 |
tcaacccgaaccaacatgcttcgggccatgcggttcggacagtttgggtcggttaatgtgtttttgttcagccctaattgatgcattaaca-ttttttga |
29273016 |
T |
 |
| Q |
201 |
tttaacaaatggtagtatctttgtt |
225 |
Q |
| |
|
|| |||||||||||||||||||||| |
|
|
| T |
29273015 |
ttaaacaaatggtagtatctttgtt |
29272991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University