View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8639_low_13 (Length: 234)
Name: NF8639_low_13
Description: NF8639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8639_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 11 - 216
Target Start/End: Original strand, 51822325 - 51822530
Alignment:
| Q |
11 |
agattattctgaagaagaagaagtgcgtacatttttcctttgttgcacatgtttggtggaattgaacccgttaagaaattctccgaaacgtcgatgtatt |
110 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51822325 |
agattgttctgaagaagaagaagtgcgtacatttttcctttgttgcacatgtttggtggaattgaacccgttaagaaattctccgaaacgtcgatgtatt |
51822424 |
T |
 |
| Q |
111 |
caaattctgaccatgatccagtcttctgaggaattggacctgttaatctgtttctgtaaagagacagttcccggaggtttttaaactcacctatctccgg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51822425 |
caaattctgaccatgatccagtcttctgaggaattggacctgttaatctgtttctgtaaagagacagttcccggaggtttttaaactcacctatctccgg |
51822524 |
T |
 |
| Q |
211 |
tggaat |
216 |
Q |
| |
|
|||||| |
|
|
| T |
51822525 |
tggaat |
51822530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University