View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8639_low_14 (Length: 229)
Name: NF8639_low_14
Description: NF8639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8639_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 46223429 - 46223645
Alignment:
| Q |
1 |
ctgatgtttatagttttggtgtgttattacttgttattgtttctgggagaagacctcttcaagtgaatgccggtggtggtggg------gatggattcaa |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
46223429 |
ctgatgtttatagttttggtgtgttattacttgttattgtttctgggagaagacctcttcaagtgaatgccggtggtagtggggatggggatggattcaa |
46223528 |
T |
 |
| Q |
95 |
gcatatttcggagtttaagcgagcaaatttggtttcttgggctagacattgtgcgcgtaatgggaaactactcgaacttgttgatccattagttgagttg |
194 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46223529 |
gcatatttcagagtttaagcgagcgaatttggtttcttgggctagacattgtgcgcgtaatgggaaactactcgaacttgttgatccattagttgagttg |
46223628 |
T |
 |
| Q |
195 |
ttgctattggatgataa |
211 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
46223629 |
ttgctattggatgataa |
46223645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University