View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8639_low_18 (Length: 224)

Name: NF8639_low_18
Description: NF8639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8639_low_18
NF8639_low_18
[»] chr2 (2 HSPs)
chr2 (20-205)||(17898682-17898867)
chr2 (100-209)||(42161169-42161278)
[»] chr8 (2 HSPs)
chr8 (91-209)||(43691594-43691712)
chr8 (101-209)||(20670192-20670300)


Alignment Details
Target: chr2 (Bit Score: 158; Significance: 3e-84; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 20 - 205
Target Start/End: Complemental strand, 17898867 - 17898682
Alignment:
20 tctatggcttaaaggatttaatcgaaaaaattgaaacttgtgatgaatttcatgcaaagatgcagggtccatatctgagacttgatatggcttgaaaaga 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17898867 tctatggcttaaaggatttaatcgaaaaaattgaaacttgtgatgcatttcatgcaaagatgcagggtccatatctgagacttgatatggcttgaaaaga 17898768  T
120 aggtctatctcacctaattattgaaaaagactcgaaagtgcgtattgacatggttaccaaacattgcaagatcaacggaaccaccc 205  Q
    |||||||||||| |||||| ||||||| ||||||||||||  ||||||||||||||||||||||||||||||||| ||||||||||    
17898767 aggtctatctcatctaattgttgaaaatgactcgaaagtgtttattgacatggttaccaaacattgcaagatcaatggaaccaccc 17898682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 100 - 209
Target Start/End: Complemental strand, 42161278 - 42161169
Alignment:
100 cttgatatggcttgaaaagaaggtctatctcacctaattattgaaaaagactcgaaagtgcgtattgacatggttaccaaacattgcaagatcaacggaa 199  Q
    |||||||||||||| |  || ||| |||||||| | ||| |||| |  ||||| ||||||| |||||| |||||||| ||  ||||||||||||| ||||    
42161278 cttgatatggcttggagtgagggtttatctcacgtgattgttgagagtgactcaaaagtgcttattgatatggttactaacaattgcaagatcaatggaa 42161179  T
200 ccaccccttc 209  Q
    ||| ||||||    
42161178 ccatcccttc 42161169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 91 - 209
Target Start/End: Original strand, 43691594 - 43691712
Alignment:
91 tatctgagacttgatatggcttgaaaagaaggtctatctcacctaattattgaaaaagactcgaaagtgcgtattgacatggttaccaaacattgcaaga 190  Q
    |||||| ||||| |||||||||||| |||||||||||||||||||||| ||||||  ||||||||||||  ||| || ||||| |||||| |||||||||    
43691594 tatctgggacttcatatggcttgaagagaaggtctatctcacctaattgttgaaagtgactcgaaagtgtttatagatatggtcaccaaaaattgcaaga 43691693  T
191 tcaacggaaccaccccttc 209  Q
    |||| ||||| ||||||||    
43691694 tcaaaggaactaccccttc 43691712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 101 - 209
Target Start/End: Complemental strand, 20670300 - 20670192
Alignment:
101 ttgatatggcttgaaaagaaggtctatctcacctaattattgaaaaagactcgaaagtgcgtattgacatggttaccaaacattgcaagatcaacggaac 200  Q
    ||||||||||||| |  || ||| |||||||| | ||| |||| |  ||||| ||||| | |||||| |||||||| ||  ||||||||||||| |||||    
20670300 ttgatatggcttggagtgagggtttatctcacgtgattgttgagagtgactcaaaagttcttattgatatggttactaacaattgcaagatcaatggaac 20670201  T
201 caccccttc 209  Q
    || ||||||    
20670200 catcccttc 20670192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University