View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8639_low_5 (Length: 352)
Name: NF8639_low_5
Description: NF8639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8639_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 8e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 8e-89
Query Start/End: Original strand, 174 - 339
Target Start/End: Complemental strand, 24061362 - 24061197
Alignment:
| Q |
174 |
gtcgtatttttgaagccttagtggattgagcctagctagttttggatcttagactgacgagaaaggctgcttggacagtccatatcaaaaactatgttgg |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24061362 |
gtcgtatttttgaagccttagtggattgagcctagctagttttggatcttagactgacgagaaaggctgcttggacagtccatatcaaaaactatgttgg |
24061263 |
T |
 |
| Q |
274 |
aaatattcaaatcaagttaagttagtatggagtagacattaggaatggtcaaatgattacatgatg |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24061262 |
aaatattcaaatcaagttaagttagtatggagtagacattaggaatggtcaaatgattacatgatg |
24061197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University