View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8639_low_9 (Length: 249)
Name: NF8639_low_9
Description: NF8639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8639_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 43 - 240
Target Start/End: Complemental strand, 6562602 - 6562404
Alignment:
| Q |
43 |
tattataacaatgactaacgaaacgtacaatcaaataccgattattgtgactgctagttgcctaaccaaaaataactatttacccgatgaagagagggta |
142 |
Q |
| |
|
|||||| || |||| |||||||| ||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6562602 |
tattatgactatgattaacgaaatgtacaatcaaataccgattattgtgaccgtaagttgcctaaccaaaaataactatttacccgatcaagagagggta |
6562503 |
T |
|
| Q |
143 |
actaggtcccaaaagaaagg-taactaggaactaacaacggtaacaaaaagaggttctagttgtactacaacgaatctcaatgttttaactgctctctg |
240 |
Q |
| |
|
|||||||||| ||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6562502 |
actaggtccctaaaaaaagggtaactaggaactaacaacggtaacaaaaagaggttctagttgtactacaacgaatctcaatgttttaactgctctctg |
6562404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University