View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8639_low_9 (Length: 249)

Name: NF8639_low_9
Description: NF8639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8639_low_9
NF8639_low_9
[»] chr2 (1 HSPs)
chr2 (43-240)||(6562404-6562602)


Alignment Details
Target: chr2 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 43 - 240
Target Start/End: Complemental strand, 6562602 - 6562404
Alignment:
43 tattataacaatgactaacgaaacgtacaatcaaataccgattattgtgactgctagttgcctaaccaaaaataactatttacccgatgaagagagggta 142  Q
    |||||| || |||| |||||||| ||||||||||||||||||||||||||| |  ||||||||||||||||||||||||||||||||| |||||||||||    
6562602 tattatgactatgattaacgaaatgtacaatcaaataccgattattgtgaccgtaagttgcctaaccaaaaataactatttacccgatcaagagagggta 6562503  T
143 actaggtcccaaaagaaagg-taactaggaactaacaacggtaacaaaaagaggttctagttgtactacaacgaatctcaatgttttaactgctctctg 240  Q
    |||||||||| ||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6562502 actaggtccctaaaaaaagggtaactaggaactaacaacggtaacaaaaagaggttctagttgtactacaacgaatctcaatgttttaactgctctctg 6562404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University