View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8640_low_4 (Length: 318)
Name: NF8640_low_4
Description: NF8640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8640_low_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 266; Significance: 1e-148; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 11 - 300
Target Start/End: Complemental strand, 7860327 - 7860038
Alignment:
| Q |
11 |
tgagatgaacaagagtttgggagatgaaaataatgggattcaatgtttggaaatacagatttagatgtaattcctcaacatgacgctgttttgcggcttc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7860327 |
tgagatgaacaagagtttgggagatgaaaataatgggattcaatgtttggaaatacagatttagatgtaattcctcaacatgacgctgttttgcggcttc |
7860228 |
T |
|
| Q |
111 |
aacccatgcatcgaagatgtcacaatcacgcttgtcatttcttccagaccaacagtttaggcgaaacgatttgagaggttggttggttgaaagaggagag |
210 |
Q |
| |
|
|| |||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7860227 |
aagccatgcattgaagatgtcacaatcacgcttgtcatttcttccagacaaacagtttaggcgaaacgatttgagaggttggttggttgaaagaggagag |
7860128 |
T |
|
| Q |
211 |
aacatgaaattatcgacaaaacgacagaagccgtcaaaggtctttaagtctttgaaggtttcatcgtgaaagtctagaactgatagtgaa |
300 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7860127 |
aacatgaaattgtcgacaaaacgacagaagccgtcgaaggtctttaagtctttgaaggtttcatcgtgaaagtctagagctgatagtgaa |
7860038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 18 - 109
Target Start/End: Complemental strand, 7871625 - 7871534
Alignment:
| Q |
18 |
aacaagagtttgggagatgaaaataatgggattcaatgtttggaaatacagatttagatgtaattcctcaacatgacgctgttttgcggctt |
109 |
Q |
| |
|
|||||| ||||| ||||||||||||| |||||||||||| |||||| |||| | |||||||| ||||||||| | |||||||||| |||| |
|
|
| T |
7871625 |
aacaagggtttgagagatgaaaataacgggattcaatgtgtggaaacgcagactaagatgtaactcctcaacacaatgctgttttgcagctt |
7871534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 43 - 121
Target Start/End: Complemental strand, 7814376 - 7814298
Alignment:
| Q |
43 |
atgggattcaatgtttggaaatacagatttagatgtaattcctcaacatgacgctgttttgcggcttcaacccatgcat |
121 |
Q |
| |
|
||||||||||| || ||||||| || || |||| | |||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
7814376 |
atgggattcaaggtgtggaaatccatatgaagattaatttcctcaacactacgctgttttgcggcttcaatccatgcat |
7814298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University