View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8640_low_5 (Length: 241)
Name: NF8640_low_5
Description: NF8640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8640_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 12818613 - 12818383
Alignment:
| Q |
1 |
gagttcaatttctgaaaccctagatcctgctcaaatgggtatttctttggctgatcttgaggatgacattgacgttga------tgttgtgggagtttct |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12818613 |
gagttcaatttctgaaaccctagatcctgctcaaatgggtatttctttggctgatcttgaggatgacattgacgttgacgttgatgttgtgggagtttct |
12818514 |
T |
|
| Q |
95 |
gagcctgaggatgcggggttaaccaacgctgagattttttccgtaatgtccaccggtgatgttccgcaggtagatattggtgatttgtcagatatttggc |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12818513 |
gagcctgaggatgcggggttaaccaacgctgatattttttccgtaatgtccaccggtgatgttccgcaggtagatattggtgatttgtcagatatttggc |
12818414 |
T |
|
| Q |
195 |
cggggccgatggatcttgctgtgtatgctcc |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
12818413 |
cggggccgatggatcttgctgtgtatgctcc |
12818383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University