View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8641_high_8 (Length: 245)
Name: NF8641_high_8
Description: NF8641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8641_high_8 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 13 - 245
Target Start/End: Original strand, 29119831 - 29120063
Alignment:
| Q |
13 |
gacatcaactctcctgaaaataagtaaccacttaaaccatcagaaaatgcagataaagaacttagcaaacttgtgcattgttacaataaatataagaatc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||| |
|
|
| T |
29119831 |
gacatcaactctcctgaaaataagtaaccacttaaaccatcagaaaatgcagataaagaacttagcaaacttatgcattgttacaataaatataagtatc |
29119930 |
T |
 |
| Q |
113 |
atcatatgttttcatgatgaaatcattattattttataattttatacgcatgttttagccattgcaattttgattattacatattgtagtgcagaattgt |
212 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29119931 |
atcatatgttttcatgatgaaatcattgttattttataattttatacgcatgttttagccattgcaattttgattattacatattgtagtgcagaattgt |
29120030 |
T |
 |
| Q |
213 |
ataacaatatcataataaaaccataatacccaa |
245 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
29120031 |
ataacagtatcataataaaaccataatacccaa |
29120063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University