View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8641_low_11 (Length: 299)
Name: NF8641_low_11
Description: NF8641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8641_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 136; Significance: 6e-71; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 13 - 168
Target Start/End: Original strand, 37157367 - 37157522
Alignment:
| Q |
13 |
aaaaacttcacaaatgtgatggattcaagcaagatttgatgaaaagtggcacaatatagtaggttttggatttggcgggattgagttttcttttcaatag |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37157367 |
aaaaacttcacaaatgtgatggattcaagcaagatttaatgaaaagtggcacgatatagtaggttttggatttggcgggattgagttttcttttcaatag |
37157466 |
T |
|
| Q |
113 |
taaataaaaatgaagaagtggaaggaagaggagggattcgaaaggtatataggatg |
168 |
Q |
| |
|
||||||||||||||| ||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
37157467 |
taaataaaaatgaaggagtaggaggaagaggagggattcgaaaggtatataggatg |
37157522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 159 - 282
Target Start/End: Original strand, 37158287 - 37158413
Alignment:
| Q |
159 |
atataggatgtgttcagattatacaatcggaacaaacnnnnnnnnc---gctctaggtgttttcacaaatacaaggaaagaatgagggttgggacgtagt |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37158287 |
atataggatgtgttcagattatacaatcggaacaaaaaaaataaaaaatgctctaggtgttttcacaaatacaaggaaagaatgagggttgggacgtagt |
37158386 |
T |
|
| Q |
256 |
tatagacaaaattggtaacactagcac |
282 |
Q |
| |
|
|| |||||||||| ||||||||||||| |
|
|
| T |
37158387 |
taaagacaaaattagtaacactagcac |
37158413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University