View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8641_low_17 (Length: 241)
Name: NF8641_low_17
Description: NF8641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8641_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 31 - 223
Target Start/End: Complemental strand, 21261156 - 21260966
Alignment:
| Q |
31 |
atatgatagcttttcaaaaagagtttttctatatatgcgcatgatcacatgtatacaaaaataaagtgtgaattaaatgattcgtttttatcaatcaaat |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
21261156 |
atatgatagcttttcaaaaagagtttttctatatatgc--atgatcacatgtatacaaaaataaagtgtgaattacatgattcgtttttatcaataaaat |
21261059 |
T |
|
| Q |
131 |
aagttaattggcccactgaattactttttgtggtattgaatatgtcatgtggacctagtagttgtcttttgaatcaacttcaaagtggatgct |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
21261058 |
aagttaattggcccactgaattactttttgtggtattgaatatgtcatgtggacctagtagctgtcttttgaatcaacttcaaagtggatgct |
21260966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University