View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8641_low_21 (Length: 229)
Name: NF8641_low_21
Description: NF8641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8641_low_21 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 29120416 - 29120188
Alignment:
| Q |
1 |
tcaatttgcttgaatttaaagttttgctgttctccaagagagagatgcattttttcattttaaattataaatgaaaggaaatctgattacagttaaattg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
29120416 |
tcaatttgcttgaatttaaagttttgctgttctccaagagagagatgcattttttcattttaaattataaatgaaaggaaatctgattacaattaaattg |
29120317 |
T |
 |
| Q |
101 |
gtgattatggtttaaatgttcatttatatataccatgatgcctttccgcaattgtagaattatatagaccgaaaacaacattacctgaatcattagttac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29120316 |
gtgattatggtttaaatgttcatttatatataccatgatgcctttccgcaattgtagaattatatagtccgaaaacaacattacctgaatcattagttac |
29120217 |
T |
 |
| Q |
201 |
tgcaccataatatagtagaaatcaaatct |
229 |
Q |
| |
|
||||||| ||||||||||||||||||||| |
|
|
| T |
29120216 |
tgcaccagaatatagtagaaatcaaatct |
29120188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University