View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8641_low_6 (Length: 420)
Name: NF8641_low_6
Description: NF8641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8641_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 75 - 395
Target Start/End: Complemental strand, 45127611 - 45127281
Alignment:
| Q |
75 |
aaattcttttcttccgcataactaattactattaataaataactttgatttacagtggtggtagcatagcatatcatagcatggtgccaaactttgcaga |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
45127611 |
aaattcttttcttccgcataactaattactattaataaataactttgatttacagtggtggtagcatagcatatcatagcatagtgccaaactttgcaga |
45127512 |
T |
|
| Q |
175 |
accccacacccacaccacctttattttccctttccctttcctttgcttgtgagttctgtcccaatacagggggctaccacacccatatctcnnnnnnnnn |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45127511 |
accccacacccacaccacctttattttccctttccctttcctttgcttgtgagttctgtcccaatacagggggctaccacacccatatctc--ttctttt |
45127414 |
T |
|
| Q |
275 |
nnnnnnncctttcattgaagaagaaaac------------cacattcacattcacattcacttcactcacactcttctctcttattatacatcatgacac |
362 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45127413 |
cttttttcctttcattgaagaagaaaaccacattcacattcacattcacattcacattcacttcactcacactcttctctcttattatacatcatgacac |
45127314 |
T |
|
| Q |
363 |
tgacactaccatctttcaatacccttcttctca |
395 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
45127313 |
tgacactaccatctttcaatacccttcttctca |
45127281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University