View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8643_high_16 (Length: 238)
Name: NF8643_high_16
Description: NF8643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8643_high_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 1253320 - 1253555
Alignment:
| Q |
1 |
ttcttttctctagtgcacgggagtaattgatgaaactttattctttaaaatcttatctatcgatacgcttgaagcttgagtgtgtgatttacttcaacaa |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
1253320 |
ttcttttccctagtgcacgggagtaattgatgaaactttattctctaaaatcttatctatcgatacgcttgaaacttgagtgtgtgattcacttcaacaa |
1253419 |
T |
 |
| Q |
101 |
atccaaatattttcaagggaattcacagttatccttatctc------------tttgcataaaccggtggaggcaaattgaatttaaaactaattagtgt |
188 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1253420 |
atccaaatattttcaaggaaattcacagttatccttatctctattacatcaagtttgcataaaccggtggaggcaaattgaatttaaaactaattagtgt |
1253519 |
T |
 |
| Q |
189 |
gtccacgcatactttagaattatttcagcaattatc |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
1253520 |
gtccacgcatactttagaattatttcagcaattatc |
1253555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University