View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8643_high_20 (Length: 216)
Name: NF8643_high_20
Description: NF8643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8643_high_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 66; Significance: 2e-29; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 105 - 194
Target Start/End: Complemental strand, 43565137 - 43565048
Alignment:
| Q |
105 |
atggctccaccaaattccacaacccttgatctcatcaaaaccgagtcattatttgatttatctgagggaaagtttaaggtgagaggtgtt |
194 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
43565137 |
atggctccaccgaattccacaaaccttgatctcatcaaaactgagtctttatttgatttatctgagggaaagtttaaggttagagatgtt |
43565048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 3 - 37
Target Start/End: Original strand, 44954838 - 44954872
Alignment:
| Q |
3 |
ccccatcatagagtaaggtttttcacttcccttca |
37 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
44954838 |
ccccatcatagagtaaggattttcacttcccttca |
44954872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 117 - 174
Target Start/End: Original strand, 43973477 - 43973534
Alignment:
| Q |
117 |
aattccacaacccttgatctcatcaaaaccgagtcattatttgatttatctgagggaa |
174 |
Q |
| |
|
||||||||| |||||||||| ||||||| ||||| |||||||||||||| ||||||| |
|
|
| T |
43973477 |
aattccacagcccttgatcttgtcaaaactgagtctttatttgatttatccgagggaa |
43973534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University