View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8643_high_21 (Length: 203)
Name: NF8643_high_21
Description: NF8643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8643_high_21 |
 |  |
|
| [»] scaffold0130 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 6e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 6e-76
Query Start/End: Original strand, 11 - 186
Target Start/End: Complemental strand, 27022120 - 27021947
Alignment:
| Q |
11 |
ttggtgttgaattgttctttggttttgtgtttaggcgttgaaagttgctaagaaattgaaagctcatactgtgtctggatattcaaatgactcgaatcca |
110 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27022120 |
ttggtgttgaattgttctttggtt--gtgtttaggcgttgaaagttgctaagaaattgaaagctcatactgtgtctggatattcaaatgactcgaatcca |
27022023 |
T |
 |
| Q |
111 |
tttggtgattccaatcttaatgagaagtaagtccctctcttctccctaannnnnnnctgtcttgtgtagtaatact |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
27022022 |
tttggtgattccaatcttaatgagaagtaagtccctctcttctccctaatttttttctgtcttgtgtagtaatact |
27021947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0130 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: scaffold0130
Description:
Target: scaffold0130; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 11 - 159
Target Start/End: Original strand, 22514 - 22662
Alignment:
| Q |
11 |
ttggtgttgaattgttctttggttttgtgtttaggcgttgaaagttgctaagaaattgaaagctcatactgtgtctggatattcaaatgactcgaatcca |
110 |
Q |
| |
|
||||| ||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |||| |||||||| |||||||| ||||||||||||||| |
|
|
| T |
22514 |
ttggtattgaattgttctttggttttgtgttcaggagttgaaagttgctaagaaattgaagactcaaactgtgtccggatattctaatgactcgaatcca |
22613 |
T |
 |
| Q |
111 |
tttggtgattccaatcttaatgagaagtaagtccctctcttctccctaa |
159 |
Q |
| |
|
||||||||||| ||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
22614 |
tttggtgattcaaatctcaatgagaagtaagttcctctcttctccctaa |
22662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University