View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8643_high_5 (Length: 313)
Name: NF8643_high_5
Description: NF8643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8643_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 93; Significance: 3e-45; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 182 - 302
Target Start/End: Complemental strand, 7879558 - 7879438
Alignment:
| Q |
182 |
aatcgatcaaccgaagagcgcatgaagagagttaattgctgctggatcatgacgagattgcaagataaaggttttgtttccagacaattccttctgtgct |
281 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| ||||| |
|
|
| T |
7879558 |
aatccatcaaccgaagagcgcatgaagagagttaatcgctgctggatcatgacgagattgcaagataaaggttttgattccaaacaattccttccgtgct |
7879459 |
T |
 |
| Q |
282 |
ttagttttcttatgatctctg |
302 |
Q |
| |
|
||||||||||| |||| |||| |
|
|
| T |
7879458 |
ttagttttcttgtgatttctg |
7879438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 206 - 292
Target Start/End: Original strand, 8588655 - 8588741
Alignment:
| Q |
206 |
aagagagttaattgctgctggatcatgacgagattgcaagataaaggttttgtttccagacaattccttctgtgctttagttttctt |
292 |
Q |
| |
|
||||||| |||| | | |||||||||||||| |||||||||||||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
8588655 |
aagagaggtaatcgttactggatcatgacgaaattgcaagataaaggttttgtttccaaacaatttcttctgtgctttagttttctt |
8588741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 61 - 121
Target Start/End: Complemental strand, 7880144 - 7880084
Alignment:
| Q |
61 |
atattgctcatgatcatgcataaagatactcatgcacacagaaatagaaccaagaggcaac |
121 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
7880144 |
atattgctcatgatcatgcataaagagactcatgcacacagaaacagaaccaagaggcaac |
7880084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University