View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8643_low_23 (Length: 237)
Name: NF8643_low_23
Description: NF8643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8643_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 11 - 219
Target Start/End: Original strand, 41314909 - 41315117
Alignment:
| Q |
11 |
gagtgagaagaatgatacgcatcttgtacaaattcaccataacgaactacctctcgacgaagattctcgtcgagaggatctaacattcctttccaatcat |
110 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41314909 |
gagtgaaaagaatgatacgcgtcttgtacaaattcaccataacgaactacctctcgacgaagattctcgtcgagaggatctaacattcctttccaatcat |
41315008 |
T |
 |
| Q |
111 |
tgcagccatggtattctctccaatgactgccaagcgtgttacggggagaatactcagctgttttgaaaaggagacggtggagatttttgaggtgatgcgg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41315009 |
tgcagccatggtattctctccaatgactgccaagcgtgttacggggagaatactcagctgttttgaaaaggagacggtggagatttttgaggtgatgcgg |
41315108 |
T |
 |
| Q |
211 |
tgacatttg |
219 |
Q |
| |
|
||||||||| |
|
|
| T |
41315109 |
tgacatttg |
41315117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University