View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8643_low_28 (Length: 203)
Name: NF8643_low_28
Description: NF8643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8643_low_28 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 7e-88; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 1 - 184
Target Start/End: Original strand, 27969662 - 27969845
Alignment:
| Q |
1 |
ggaatattaaactttgctagattgttgaagtgactcaatcctcataaaaagttcggtaaaaatgatgatgaggaagaaagcttaggttggattcagacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27969662 |
ggaatattaaactttgctagattgctgaagtgactcaatcctcataaaaagttcggtgaaaatgatgatgaggaagaaagcttaggttggattcagacaa |
27969761 |
T |
|
| Q |
101 |
caattggatcctcgtatgatacactcgagatgcatttcttgaatttcgtcttatgtggcttaaaacaagttgagaatgactttc |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| ||||||| |
|
|
| T |
27969762 |
caattggatcctcgtatgatacactcgagatgcatttcttgaatttcgtcttatgtagctgaaaacaagttgagaacgactttc |
27969845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 1 - 184
Target Start/End: Original strand, 27862800 - 27862984
Alignment:
| Q |
1 |
ggaatattaaactttgctagattgttgaagtgactcaatcctcataaaaagttcggtaaaaatgatgatgaggaagaaagcttaggttg-gattcagaca |
99 |
Q |
| |
|
|||||||||||| ||||||||||||||||| || ||||| |||||| ||||| ||||||||||||||||||||||||||| ||||||| ||||| |||| |
|
|
| T |
27862800 |
ggaatattaaacattgctagattgttgaagagattcaatggtcataagaagtttggtaaaaatgatgatgaggaagaaagcgtaggttgtgattccgaca |
27862899 |
T |
|
| Q |
100 |
acaattggatcctcgtatgatacactcgagatgcatttcttgaatttcgtcttatgtggcttaaaacaagttgagaatgactttc |
184 |
Q |
| |
|
||||||||||||| |||||||| || ||| | ||| |||||||||||||||||||| ||| ||||||| ||||||| ||||||| |
|
|
| T |
27862900 |
acaattggatccttttatgatacgcttgagcttcatgtcttgaatttcgtcttatgtagctgaaaacaaattgagaacgactttc |
27862984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University