View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8645_low_2 (Length: 257)
Name: NF8645_low_2
Description: NF8645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8645_low_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 1e-96; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 28 - 210
Target Start/End: Complemental strand, 42639350 - 42639168
Alignment:
| Q |
28 |
cacagagtggccatgtgcccctaacaaaggttactatggtcgtggaccgattcaactttcttggaactacaactatggaccagctggaagagacaatggt |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42639350 |
cacagagtggccatgtgcccctaacaaaggttactatggtcgtggaccgattcaactatcttggaactacaactatggaccagctggaagagacaatggt |
42639251 |
T |
|
| Q |
128 |
tttgatggattgaactcacctgaaacagtggccaatgatcctacagtgtccttcaagacagcattatggtattggatgaataa |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42639250 |
tttgatggattgaactcacctgaaacagtggccaatgatcctacagtgtccttcaagacagcattatggtattggatgaataa |
42639168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 23 - 208
Target Start/End: Complemental strand, 42634278 - 42634093
Alignment:
| Q |
23 |
agcagcacagagtggccatgtgcccctaacaaaggttactatggtcgtggaccgattcaactttcttggaactacaactatggaccagctggaagagaca |
122 |
Q |
| |
|
|||| |||||||| || ||||||||||||||||| |||||||| ||||||||||||||| | |||||||||| || || ||||||||||||| |||| |
|
|
| T |
42634278 |
agcaacacagagtacccgtgtgcccctaacaaaggatactatggccgtggaccgattcaattatcttggaactttaattacggaccagctggaaaggaca |
42634179 |
T |
|
| Q |
123 |
atggttttgatggattgaactcacctgaaacagtggccaatgatcctacagtgtccttcaagacagcattatggtattggatgaat |
208 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42634178 |
gtggttttgatgaattgaactctcctgaaacagtggccaatgatcctttagtgtccttcaagacagcattatggtattggatgaat |
42634093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 119 - 169
Target Start/End: Complemental strand, 42628638 - 42628588
Alignment:
| Q |
119 |
gacaatggttttgatggattgaactcacctgaaacagtggccaatgatcct |
169 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42628638 |
gacaatggttctgatggattgaactctcctgaaacagtggccaatgatcct |
42628588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 39 - 82
Target Start/End: Complemental strand, 42628694 - 42628651
Alignment:
| Q |
39 |
catgtgcccctaacaaaggttactatggtcgtggaccgattcaa |
82 |
Q |
| |
|
||||||||||||||||||| | ||||||| |||||||||||||| |
|
|
| T |
42628694 |
catgtgcccctaacaaagggttctatggttgtggaccgattcaa |
42628651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University