View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8646_low_8 (Length: 243)

Name: NF8646_low_8
Description: NF8646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8646_low_8
NF8646_low_8
[»] chr4 (1 HSPs)
chr4 (140-232)||(10545797-10545889)


Alignment Details
Target: chr4 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 140 - 232
Target Start/End: Original strand, 10545797 - 10545889
Alignment:
140 gagattgatcattgaatatatgaaaaacaatgatgatgttgttaaatttgcagggaaattgtgtgtgttactgaatttggattggattgatgt 232  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
10545797 gagattgatcattgaatatatgaaaaacaatgatgatgttgttaaatttgcagggaaattgtgcgtgttactgaatttggattggattgatgt 10545889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University