View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8647_low_11 (Length: 205)
Name: NF8647_low_11
Description: NF8647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8647_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 9 - 187
Target Start/End: Original strand, 31454992 - 31455170
Alignment:
| Q |
9 |
cagagacaattcaaagtgatttagttgtgcttgcagagctatacaattgcatggaagaactcttccaatctcaacaaacacaacaagcacttttacacta |
108 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31454992 |
cagagacaattcaaagtgatttggttgtgcttgctgagttatacaattgcatggaagaactcttccaatctcaacaaacacaacaagcacttttacacta |
31455091 |
T |
|
| Q |
109 |
tcaaaatgggaagctagtggaagattcattaagtggttcagttacacttttagatgcatgtagttcatcaagggaatta |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
31455092 |
tcaaaatgggaagctagtggaagattcattaagtggttcagttacacttttagatgcatgtggttcatcaagggaatta |
31455170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 5 - 94
Target Start/End: Complemental strand, 9385465 - 9385376
Alignment:
| Q |
5 |
gaagcagagacaattcaaagtgatttagttgtgcttgcagagctatacaattgcatggaagaactcttccaatctcaacaaacacaacaa |
94 |
Q |
| |
|
|||||||||| |||||| ||||| ||||| | |||||||||| | |||||||| ||||||||||||||| | |||| |||||| |||||| |
|
|
| T |
9385465 |
gaagcagagaaaattcagagtgacttagtagggcttgcagagatttacaattgtatggaagaactcttcaactctccacaaactcaacaa |
9385376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University