View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8647_low_6 (Length: 326)
Name: NF8647_low_6
Description: NF8647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8647_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 1 - 314
Target Start/End: Complemental strand, 45554448 - 45554135
Alignment:
| Q |
1 |
cgcctagctgtaacatgtgaaggtacaaataaatggattgttgaaaagggccagaccaagcataagttcggatcatcatgttccacaaaacaacacttgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45554448 |
cgcctagctgtaacatgtgaaggtacaaataaatggattgttgaaaagggccagaccaagcataagttcggatcatcatgttccacaaaacaacacttgg |
45554349 |
T |
 |
| Q |
101 |
ctttggaatttggtcgaacacgtgacgggcgagttggatttcattgcgtgagatatggtaacgggcaagctgtgttgctgctgcatcagaatcagaaaca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45554348 |
ctttggaatttggtcgaacacgtgacgggcgagttggatttcattacgtgagatatggtaacgggcaagctgtgttgctgctgcatcagaatcagaaaca |
45554249 |
T |
 |
| Q |
201 |
cgatgaggatgaggatgaggactgaagcttcgaatctgccggtgcctttgccgccaattgattaggaggattgaaactacttcgcgtttcaaacatctta |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45554248 |
cgatgaggatgaggatgaggactgaagcttcgaatctgccggtgcctttgccgccaattgattaggaggattgaaactacttcgcgtttcaaacatctta |
45554149 |
T |
 |
| Q |
301 |
ttcgcatctctgct |
314 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
45554148 |
ttcgcatctttgct |
45554135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University