View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8648_high_3 (Length: 338)
Name: NF8648_high_3
Description: NF8648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8648_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 124 - 319
Target Start/End: Complemental strand, 7364547 - 7364352
Alignment:
| Q |
124 |
ggtggtgtaggagagggtgatgaagtagtattttgagggggtgtagaaagttctgggaggttaagttttgcatcagaaccataaagtttacgagcagcag |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7364547 |
ggtggtgtaggagagggtgatgaagtagtattttgagggggtgtagaaagttctgggaggttaagttttgcatcagaaccataaagtttacgagcagcag |
7364448 |
T |
 |
| Q |
224 |
catcataagctaaagcagcttcatgagaggtttcaaaagtaccaagccaaagacgagcaccacgattaggttcgcggatttcagccacccatttac |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7364447 |
catcataagctaaagcagcttcatgagaggtttcaaaagtaccaagccaaagacgagcaccacgattaggttcgcgaatttcagccacccatttac |
7364352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 54; Significance: 6e-22; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 202 - 319
Target Start/End: Complemental strand, 52690676 - 52690559
Alignment:
| Q |
202 |
ccataaagtttacgagcagcagcatcataagctaaagcagcttcatgagaggtttcaaaagtaccaagccaaagacgagcaccacgattaggttcgcgga |
301 |
Q |
| |
|
|||||||| ||| | || |||||||||||||| |||||||||||| | || || ||||| || ||||||||||| |||| ||||||||| ||||| |||| |
|
|
| T |
52690676 |
ccataaagcttaagtgcggcagcatcataagccaaagcagcttcaagggatgtctcaaatgtcccaagccaaaggcgagaaccacgattgggttcacgga |
52690577 |
T |
 |
| Q |
302 |
tttcagccacccatttac |
319 |
Q |
| |
|
||||||| |||||||||| |
|
|
| T |
52690576 |
tttcagcaacccatttac |
52690559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University