View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8648_high_5 (Length: 313)
Name: NF8648_high_5
Description: NF8648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8648_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 20 - 301
Target Start/End: Original strand, 39595822 - 39596103
Alignment:
| Q |
20 |
cctaagttatctcaacttcatctctctaattctaattcctttatcagagatgtaaactacaggttatctctctttctcggtctctatgtaatgtttgtgt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
39595822 |
cctaagttatctcaacttcatctctctaattctaattcctttatcagagatgtaaactacaggttatctcgctttctcggtctctatgtaatgtttgtgt |
39595921 |
T |
 |
| Q |
120 |
agattattattatttatgaatgttttaatttgaattgtgttgtgatattgatgcagctgtggttcgtgtggttatgagctgaacttgaattcaagcaacc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39595922 |
agattattattatttatgaatgttttaatttgaattgtgttgtgatattgatgcagctgtggttcgtgtggttatgagctgaacttgaattcaagcaacc |
39596021 |
T |
 |
| Q |
220 |
gcaacacaacattgtctctaactgattcaaattatggaaaatcaattaaaaagaggaagagatgtctgatttccttcttctc |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39596022 |
gcaacacaacattgtctctaactgattcaaattatggaaaatcaattaaaaagaggaagagatgtctgatttccttcttctc |
39596103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University