View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8648_low_13 (Length: 293)
Name: NF8648_low_13
Description: NF8648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8648_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 30 - 275
Target Start/End: Original strand, 28949628 - 28949872
Alignment:
| Q |
30 |
cgtgttagacagtcagacctatttcatttttgtagtgcatatctgaattgcatgacccaacctttatttgggttgagcctatttaggccacaccattaaa |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28949628 |
cgtgttagacagtcagacctatttcatttttgtagtgcatatctgaattgcatgacccaacctttatttgggttgagcctatttgggccacaccattaaa |
28949727 |
T |
 |
| Q |
130 |
tttaaatttacatgcataaacgc-catcttttataattttccttttaaacgagtttcatgaagattcaccaatgatacaaaatagtttttacatccttat |
228 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||||||| |||||| ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
28949728 |
tttaaatttacaagcataaacgctcatcttttataattttccttttaaatgagttt-atgaagattcacc-atgatacaaaatagtttttacatccttat |
28949825 |
T |
 |
| Q |
229 |
tcaatacgaacccaccattatactattgtgtaaacctatattatcac |
275 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||| ||||||||||| |
|
|
| T |
28949826 |
tcaatacgaacccaccatcatattattgtgtaaacttatattatcac |
28949872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University