View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8649_low_10 (Length: 257)
Name: NF8649_low_10
Description: NF8649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8649_low_10 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 39 - 238
Target Start/End: Original strand, 3576575 - 3576775
Alignment:
| Q |
39 |
tgtgccaatgcaatgaatgttaatgatgatcatgcaggaaatgtaaattattcttccaaaa---tctttactatcatatcaccagtaataaatatctttc |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| || ||||| |
|
|
| T |
3576575 |
tgtgccaatgcaatgaatgttaatgatgatcatgcaagaaatgtaaattattcttccaaaatattctttactatcatatcaccagtaatacatcgctttc |
3576674 |
T |
|
| Q |
136 |
ttaatcactttttctatatannnnnnnnatttactgttgtcctctgcaggaaattaagactataagaaaatgtcttaattaaggatttcttttagggcct |
235 |
Q |
| |
|
| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3576675 |
tcaatcactttttctatatattttttt--tttactgttgtcctctgcaggaaattaagactataagaaaatgtcttaattaagggtttcttttagggcct |
3576772 |
T |
|
| Q |
236 |
tcc |
238 |
Q |
| |
|
||| |
|
|
| T |
3576773 |
tcc |
3576775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 3576503 - 3576549
Alignment:
| Q |
1 |
agtgaaatattcggtgcatttagatctttcttcaagtttgtgccaat |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3576503 |
agtgaaatattcggtgcatttagatctttcttcaagtttgtgccaat |
3576549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University