View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8650_high_15 (Length: 245)
Name: NF8650_high_15
Description: NF8650
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8650_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 23 - 229
Target Start/End: Original strand, 56177173 - 56177378
Alignment:
| Q |
23 |
tgagaagcgtatttcacgttataaagttgaagtaacaagtactcaacaaaaaactattttggatggaaatggttggcttgtagaagaggttatgaacttc |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56177173 |
tgagaagcgtatttcacgttataaagttgaagtaacaagtactcaacaaaaaactattttggatggaaatggttggcttgtagaagaggttatgaacttc |
56177272 |
T |
 |
| Q |
123 |
catggagttcctcttggtgattattttaatgtgagtaagtcaatttatcaagttccttgtctttctcttttcctttttaacaaatctaacttatttgtta |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
56177273 |
catggagttcctcttggtgattattttaatgtgagtaagtcaatttatcaagttccttgtctttctcttttcctttttaacaaatctaacttattt-tta |
56177371 |
T |
 |
| Q |
223 |
tatatct |
229 |
Q |
| |
|
||||||| |
|
|
| T |
56177372 |
tatatct |
56177378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 23 - 158
Target Start/End: Original strand, 9999489 - 9999627
Alignment:
| Q |
23 |
tgagaagcgtatttcacgttataaagttgaagtaacaagtactcaacaaaaaacta---ttttggatggaaatggttggcttgtagaagaggttatgaac |
119 |
Q |
| |
|
|||||||| ||||| ||||||||| |||||| ||||||||||| |||| | || ||||||||||||| |||||| |||| ||||||||| | || |
|
|
| T |
9999489 |
tgagaagcacatttcgagttataaaggtgaagtgacaagtactcagcaaagatctccccttttggatggaaagggttgggttgttgaagaggttttaaat |
9999588 |
T |
 |
| Q |
120 |
ttccatggagttcctcttggtgattattttaatgtgagt |
158 |
Q |
| |
|
| ||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
9999589 |
cttcatggtgttcctcttggtgattatttcaatgtgagt |
9999627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University