View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8650_high_21 (Length: 236)
Name: NF8650_high_21
Description: NF8650
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8650_high_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 19 - 224
Target Start/End: Complemental strand, 41571005 - 41570800
Alignment:
| Q |
19 |
aataagtgctgaataaattttatcaagtattctattctttcacaactttcatagtttatcacatgatcacatctactatatctacgatctatctaatcat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41571005 |
aataagtgctgaataaattttatcaagtattctattttttcacaactttcatagtttatcacatgatcacatctactatatctacgatctatctaatcat |
41570906 |
T |
|
| Q |
119 |
ctatgcgtgtaagaggaattatgatcgcaactgaacgaactatatattatacataatagcaaattggttatttttatctatttctacttgaaagatgaaa |
218 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41570905 |
ctatgcgtggaagaggaattatgatcgcaactgaacgaactatatattatacataatagcaaattggttatttttatctatttctacttgaaagatgaaa |
41570806 |
T |
|
| Q |
219 |
agtatg |
224 |
Q |
| |
|
|||||| |
|
|
| T |
41570805 |
agtatg |
41570800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University