View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8650_high_27 (Length: 223)
Name: NF8650_high_27
Description: NF8650
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8650_high_27 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 167; Significance: 1e-89; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 17 - 204
Target Start/End: Original strand, 5429290 - 5429485
Alignment:
| Q |
17 |
agatgactaaaccaattgattcgcgacgaccttagcttgacttcatcccctgctcacttgttaggcttttctttctttctttgttgaatccctcgcttca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5429290 |
agatgactaaaccaattgattcgcgacgaccttagcttgacttcatcccctgctcacttgttaggcttttctttctttctttgttgaatccctcgcttca |
5429389 |
T |
|
| Q |
117 |
cttcgc--------ttcatccattcatgtcttctgcaagaaccgacacaaggatccatgacgtgttcctaagttttagaggcgaagatactcgagg |
204 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5429390 |
cttcgcttcatccattcatccattcatgtcttctgcaagaaccgacacaaggatccatgacgtgttcctaagttttagaggcgaagatactcgagg |
5429485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 145 - 201
Target Start/End: Complemental strand, 5108057 - 5108001
Alignment:
| Q |
145 |
aagaaccgacacaaggatccatgacgtgttcctaagttttagaggcgaagatactcg |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
5108057 |
aagaaccgacacaaggatccatgacgtgttcctaagtttcagaggcaaagatactcg |
5108001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 156 - 201
Target Start/End: Original strand, 5443942 - 5443987
Alignment:
| Q |
156 |
caaggatccatgacgtgttcctaagttttagaggcgaagatactcg |
201 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
5443942 |
caaggatccatgacgtgttcttaagttttagagggaaagatactcg |
5443987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 201
Target Start/End: Complemental strand, 5185121 - 5185077
Alignment:
| Q |
157 |
aaggatccatgacgtgttcctaagttttagaggcgaagatactcg |
201 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||| ||||||||||| |
|
|
| T |
5185121 |
aaggatccatgatgtgttcttaagttttagaggggaagatactcg |
5185077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 155 - 201
Target Start/End: Original strand, 5422040 - 5422086
Alignment:
| Q |
155 |
acaaggatccatgacgtgttcctaagttttagaggcgaagatactcg |
201 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||| || |||||||| |
|
|
| T |
5422040 |
acaaggatccatgatgtgttcttaagttttagaggagaggatactcg |
5422086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University