View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8650_low_24 (Length: 268)
Name: NF8650_low_24
Description: NF8650
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8650_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 10 - 252
Target Start/End: Original strand, 28790338 - 28790578
Alignment:
| Q |
10 |
gcagagaggtttcatttgaggacatagagatactgtgtgtgggaccactgtacctatacttttgcctttgacgacagagggtcgtataaggacccacata |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28790338 |
gcagagaggtttcatttgaggacatagagatactgtgtgtgggaccactgtacctatacttttgcctttgacgacagagggtcgtataaggacccacata |
28790437 |
T |
 |
| Q |
110 |
aagtttttgtgtactgcagtggtagtaatagttgtattgttgtagtatatcccaaatcatatttatcttttacaagaagactaacttcaatcatat---a |
206 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
28790438 |
aag--tttgtgtactgcagtggtagtaatagttgta---ttgtagtatatcccaaatcatatttatcttttacaagaagactaacttcaatcatataaca |
28790532 |
T |
 |
| Q |
207 |
acatatcatgtacatgattatttatgcataattcaaacaaatgatt |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28790533 |
acatatcatgtacatgattatttatgcataattcaaacaaatgatt |
28790578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University