View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8650_low_41 (Length: 228)
Name: NF8650_low_41
Description: NF8650
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8650_low_41 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 12 - 212
Target Start/End: Original strand, 6262234 - 6262434
Alignment:
| Q |
12 |
ggagcagcacaggtcaaaaatttggggacacataatgggaaacagaaatttgaatccaaattatgttgttcctcggtggataccacaatttgaatgcaga |
111 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6262234 |
ggagcagctcaggtcaaaaatttggggacacataatgggaaacagaaatttgaatccaaattatgttgttcctcggtggataccacaatttgaatgcaga |
6262333 |
T |
|
| Q |
112 |
agtgaagctagaaccttggttgttctagatgatgtttggtcacaagcagttcttgaacagcttgtgtgtagaataccaggttgcaagtttgttgttgttt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6262334 |
agtgaagctagaaccttggttgttctagatgatgtttggtcacaagcagttcttgaacagcttgtgtgtagaataccaggttgcaagtttgttgttgttt |
6262433 |
T |
|
| Q |
212 |
c |
212 |
Q |
| |
|
| |
|
|
| T |
6262434 |
c |
6262434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 12 - 85
Target Start/End: Original strand, 6271334 - 6271407
Alignment:
| Q |
12 |
ggagcagcacaggtcaaaaatttggggacacataatgggaaacagaaatttgaatccaaattatgttgttcctc |
85 |
Q |
| |
|
|||||||| ||| |||| ||||||||||||||||||||||| ||| ||| ||| | |||||||||||||||| |
|
|
| T |
6271334 |
ggagcagctgagggcaaagatttggggacacataatgggaaatggaagtttcaataccaattatgttgttcctc |
6271407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University