View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8650_low_45 (Length: 223)

Name: NF8650_low_45
Description: NF8650
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8650_low_45
NF8650_low_45
[»] chr6 (5 HSPs)
chr6 (17-204)||(5429290-5429485)
chr6 (145-201)||(5108001-5108057)
chr6 (156-201)||(5443942-5443987)
chr6 (157-201)||(5185077-5185121)
chr6 (155-201)||(5422040-5422086)


Alignment Details
Target: chr6 (Bit Score: 167; Significance: 1e-89; HSPs: 5)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 17 - 204
Target Start/End: Original strand, 5429290 - 5429485
Alignment:
17 agatgactaaaccaattgattcgcgacgaccttagcttgacttcatcccctgctcacttgttaggcttttctttctttctttgttgaatccctcgcttca 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5429290 agatgactaaaccaattgattcgcgacgaccttagcttgacttcatcccctgctcacttgttaggcttttctttctttctttgttgaatccctcgcttca 5429389  T
117 cttcgc--------ttcatccattcatgtcttctgcaagaaccgacacaaggatccatgacgtgttcctaagttttagaggcgaagatactcgagg 204  Q
    ||||||        ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5429390 cttcgcttcatccattcatccattcatgtcttctgcaagaaccgacacaaggatccatgacgtgttcctaagttttagaggcgaagatactcgagg 5429485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 145 - 201
Target Start/End: Complemental strand, 5108057 - 5108001
Alignment:
145 aagaaccgacacaaggatccatgacgtgttcctaagttttagaggcgaagatactcg 201  Q
    ||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||    
5108057 aagaaccgacacaaggatccatgacgtgttcctaagtttcagaggcaaagatactcg 5108001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 156 - 201
Target Start/End: Original strand, 5443942 - 5443987
Alignment:
156 caaggatccatgacgtgttcctaagttttagaggcgaagatactcg 201  Q
    |||||||||||||||||||| |||||||||||||  ||||||||||    
5443942 caaggatccatgacgtgttcttaagttttagagggaaagatactcg 5443987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 201
Target Start/End: Complemental strand, 5185121 - 5185077
Alignment:
157 aaggatccatgacgtgttcctaagttttagaggcgaagatactcg 201  Q
    |||||||||||| |||||| ||||||||||||| |||||||||||    
5185121 aaggatccatgatgtgttcttaagttttagaggggaagatactcg 5185077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 155 - 201
Target Start/End: Original strand, 5422040 - 5422086
Alignment:
155 acaaggatccatgacgtgttcctaagttttagaggcgaagatactcg 201  Q
    |||||||||||||| |||||| ||||||||||||| || ||||||||    
5422040 acaaggatccatgatgtgttcttaagttttagaggagaggatactcg 5422086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University